ID photo of Ciro Santilli taken in 2013 right eyeCiro Santilli OurBigBook logoOurBigBook.com  Sponsor 中国独裁统治 China Dictatorship 新疆改造中心、六四事件、法轮功、郝海东、709大抓捕、2015巴拿马文件 邓家贵、低端人口、西藏骚乱
taxonomy.bigb
= Taxonomy
{wiki=Taxonomy_(biology)}

= Taxonomy
{disambiguate=biology}
{synonym}

= Autothrophs and heterothrophs
{parent=Taxonomy}

= Autothroph
{parent=Autothrophs and heterothrophs}
{wiki}

= Chemosynthesis
{parent=Autothroph}
{wiki}

= Hydrogen sulfide chemosynthesis
{parent=Chemosynthesis}

= Hydrogen chemosynthesis
{parent=Chemosynthesis}

= Photosynthesis
{parent=Autothroph}
{wiki}

It is quite cool that <photosynthesis> works just like <cellular respiration> by producing a proton potential through <chemiosmosis>.

= Heterotroph
{parent=Autothrophs and heterothrophs}
{wiki}

= Phylogenetics
{parent=Taxonomy}
{wiki}

= Last universal common ancestor
{parent=Phylogenetics}
{wiki}

= LUCA
{c}
{synonym}

= Phylogenetic tree
{parent=Phylogenetics}
{wiki}

= Tree of life
{synonym}
{title2}

It is important to note that due to <horizontal gene transfer>, the early days of life, and still <bacteria> to this day due to <bacterial conjugation>, are actually a <graph> and not a <tree (data structure)>, see also: <image Graph of life>.

Definitely have a look at: <coral of life> representations.

= Cladogram
{parent=Phylogenetic tree}
{wiki}

TODO vs <Phylogenetic tree>? https://www.visiblebody.com/blog/phylogenetic-trees-cladograms-and-how-to-read-them[]:
> Cladograms and phylogenetic trees are functionally very similar, but they show different things. Cladograms do not indicate time or the amount of difference between groups, whereas phylogenetic trees often indicate time spans between branching points.

= Coral of life
{parent=Phylogenetic tree}
{wiki}

\Image[https://upload.wikimedia.org/wikipedia/commons/9/98/TheCoralOfLifePrototype.png]
{title=Coral of life by János Podani (2019)}
{description=
Fantastic work!!! Some cool things we can easily see:
* <archaea are more cosely related to the eukaryotes than bacteria>
}
{height=1000}

= OneZoom
{c}
{parent=Phylogenetic tree}

Interesting <fractal> approach to a <phylogenetic tree>: https://www.onezoom.org/

Mostly data driven.

= Mono and paraphyly
{parent=Phylogenetics}

= Clade
{parent=Mono and paraphyly}
{tag=Good}
{wiki}

= Monophyly
{parent=Clade}
{wiki}

Basically the same as <clade>.

= Paraphyly
{parent=Mono and paraphyly}
{tag=Evil}
{wiki}

= Paraphyletic subgroup
{parent=Paraphyly}

= Non-clade groups are evil
{parent=Paraphyly}

All non-clade groups are evil. All non-clade terms must be forgotten. Some notable ones:
* <fish> excluding <tetrapods>
* <reptile> excluding <birds>
* <prokaryotes> including <archaea>

= Basal
{disambiguate=phylogenetics}
{parent=Phylogenetics}
{wiki}

= Basal
{synonym}

When a characteristic is basal, it basically means the opposite of it being <polyphyletic>.

E.g. <monotremes> laying eggs did not evolve separately after function loss, it comes directly from <reptiles>.

= Crown group
{parent=Phylogenetics}
{wiki}

Kind of the opposite of a <basal (phylogenetics)> group.

= Polyphyly
{parent=Phylogenetics}
{wiki}

= Polyphyletic
{synonym}

Basically mean that <parallel evolution> happened. Some cool ones:
* <homeothermy>: <mammals> and <birds>
* <animal flight>: <bats>, <birds> and insects
* <multicellularity>: evolved a bunch of times

= Parallel evolution
{parent=Polyphyly}
{wiki}

The cool thing about <parallel evolution> is that it shows how complex <phenotype> can evolve from very different initial genetic conditions, highlighting the great power of <evolution>.

We list some cool ones at: <polyphyly>.

= Taxonomy database
{parent=Taxonomy}

* https://eol.org/ Encyclopedia of Life

= Taxonomic rank
{parent=Taxonomy}
{wiki}

Naming taxonomic ranks like <genus>, <domain (biology)>, etc. is a fucking waste of time, only useful before we developed <molecular biology>.

All that matters is the tree of <clades> with examples of species in each clade, and common characteristics shared by the clade.

And with <molecular biology>, we can build those trees incredibly well for <extant> species. When <extinct> species are involved however, things get more complicated.

= Genus
{parent=Taxonomic rank}
{wiki}

= Domain
{disambiguate=biology}
{parent=Taxonomic rank}
{wiki}

= Kingdom
{disambiguate=biology}
{parent=Taxonomic rank}
{wiki}

There's six to eight in different systems of the end of the 20th century:
* <animal>
* <archaea>
* <bacteria>
* <fungus>
* <plant>
This mess is because people don't realize that <clades> are all that really matter.

= Phylum
{parent=Taxonomic rank}
{wiki}

There's about 60 of them.

= Class
{disambiguate=biology}
{parent=Taxonomic rank}
{wiki}

= Aerobic and anaerobic organisms
{parent=Taxonomy}
{wiki}

= Aerobic organism
{parent=Aerobic and anaerobic organisms}
{wiki}

= Aerobic
{synonym}

\Video[https://www.youtube.com/watch?v=JYc_LlMmvTk]
{title=Do Bacteria Need Oxygen? by <Microscope Project (YouTube channel)> (2022)}
{description=Shows how (persumed) <aerobic> bacteria flock towards an air bublle in water.}

= Anaerobic organism
{parent=Aerobic and anaerobic organisms}
{wiki}

= Unicellular and multicellular organisms
{parent=Taxonomy}
{wiki}

= Unicellular organism
{parent=Unicellular and multicellular organisms}
{wiki}

= Unicellular
{synonym}

= Multicellular organism
{parent=Unicellular and multicellular organisms}
{wiki}

= Multicellular
{synonym}

= Multicellularity
{synonym}

= Developmental biology
{parent=Multicellular organism}
{wiki}

\Video[https://www.youtube.com/watch?v=AC2_S-wcJes]
{title=Where is Anatomy Encoded in Living Systems? by Michael Levin (2022)}
{description=
* we are very far from full understanding. End game is a design system where you draw the body and it compiles the DNA for you.
* some cool mentions of <regeneration>
}

= Body development
{synonym}

= Developmental biology lab
{parent=Developmental biology}

= Developmental genetics
{parent=Developmental biology}
{wiki}

How genes form bodies.

\Video[https://www.youtube.com/watch?v=tpIgJF69u90]
{title=Developmental Genetics 1 by Joseph Ross (2020)}
{description=Talks about <homeobox genes>.}

= Developmental neurobiology
{parent=Developmental genetics}

= Development of the brain
{synonym}

This is hot shit, a possible worst case but sure to get there scenario to understand the <brain>!

= Homeobox gene
{parent=Developmental genetics}
{tag=Gene}
{wiki}

= Hox gene
{parent=Homeobox gene}
{wiki}

= Regeneration
{disambiguate=biology}
{parent=Developmental genetics}
{wiki}

= Regeneration
{synonym}

Some good mentions at: <video Where is Anatomy Encoded in Living Systems? by Michael Levin (2022)>.

= Chimera
{disambiguate=genetics}
{parent=Multicellular organism}
{wiki}

= Germline and somatic cells
{parent=Multicellular organism}

= Germline
{parent=Germline and somatic cells}
{wiki}

It is quite mind blowing when you think about it, that the huge majority of your body's cells is essentially just there to support a tiny ammount of germline, which are the only cells that can actually pass on! It is fun to imagine the <cell type tree> for this, with a huge branching of somatic cells, and only a few germline going forward.

= Somatic cell
{parent=Germline and somatic cells}

= The simplest multicellular species
{parent=Multicellular organism}

One of the simplest known seems to be: https://en.wikipedia.org/wiki/Trichoplax

https://www.u-tokyo.ac.jp/focus/en/articles/a_00220.html "The simplest multicellular organism unveiled" from 2013 mentions Tetrabaena socialis.

Then of course: <Caenorhabditis elegans> is a relatively simple and widely studied <model organism>.

\Video[https://www.youtube.com/watch?v=1v6cgSkiHik]
{title=Nicole King (UC Berkeley, HHMI) 1: The origin of animal multicellularity by iBiology (2015)}
{description=
* https://youtu.be/1v6cgSkiHik?t=513 <multicellularity is polyphyletic>, e.g. evolved separately on <plants>, <fungi> and <animals>.
* https://youtu.be/1v6cgSkiHik?t=668 describes how <unicellular organism> choanoflagellates form <colony (biology)>, and how animals are characterized by certain key types of cellular interaction: adhesion, communication, regulation (cell differentiation) and extra cellular matrix production
}

= Colony
{disambiguate=biology}
{parent=Multicellular organism}
{wiki}

It is hard to distinguish between colonies of <unicellular organism> and <multicellular organism> as there is a continuum between both depending on how well integrated they cells are.

= Multicellularity is polyphyletic
{parent=Multicellular organism}

= Multicellularity evolved separately multiple times
{synonym}

From Wikipedia:
> Multicellularity has evolved independently at least 25 times in eukaryotes
and:
> Complex multicellular organisms evolved only in six eukaryotic groups: animals, symbiomycotan fungi, brown algae, red algae, green algae, and land plants.

= Microorganism
{parent=Taxonomy}
{wiki}

= Prokaryote
{parent=Taxonomy}
{tag=Domain (biology)}
{wiki}

= Prokaryotic
{synonym}

Anything that is not <eukaryote>, i.e. <archaea> and <bacteria>, see e.g.: <image Coral of life by János Podani (2019)>.

Not a <clade>, and therefore <non-clade groups are evil>[a term better forgotten]!

A clade name for <arkarya> is a proposed clade name for <archaea> plus <eukarya>.

= Species
{parent=Taxonomy}
{wiki}

= Virus
{parent=Species}
{wiki}

= Virus classification
{c}
{parent=Virus}

= Bacteriophage
{parent=Virus classification}
{wiki}

= Phage
{synonym}
{title2}

= Phi X 174
{c}
{parent=Bacteriophage}
{tag=Model organism}
{wiki}

= ΦX174
{synonym}
{title2}

= Bacteriophage ΦX174
{synonym}

= Baltimore classification
{c}
{parent=Virus classification}
{wiki=Virus_classification\#Baltimore_classification}

= Positive-strand RNA virus
{c}
{parent=Baltimore classification}
{wiki}

= +ssRNA
{c}
{synonym}
{title2}

It just has <RNA> that can be <transcribed (biology)> directly by the host <ribosome>.

= Coronavirus
{parent=Virus}
{tag=Positive-strand RNA virus}

https://youtu.be/oCelMyMtRCk?t=167 mentions that they get their lipid layer from the <Golgi complex> of the host, where they replicate.

= Coronavirus Replication Cycle
{parent=Coronavirus}

https://www.youtube.com/watch?v=zvuYJTL90J8&t=166s The Coronavirus Replication Cycle by Kevin Tokoph (2020)

= COVID-19
{c}
{parent=Coronavirus}
{tag=Infection}
{tag=Respiratory disease}
{wiki}

COVID happens in two stages:
* viral infection
* <inflammatory> phase, where the body takes over, and sometimes harms itself. It seems that people are not generally contagious at this point?

This distinction is one of the reasons why separating the virus name (SARS-CoV-2) from the disease makes sense: the disease is much broader than the viral infection.

= Why it takes several days to enter inflammatory phase in COVID-19?
{parent=COVID-19}
{wiki}

https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7247969/

Why is it there such a clear separation of phases?

Why do people with mild symptoms go on to die? It is a great mystery.

<Ciro Santilli>'s theory is that COVID is extremely effective at avoiding <immune response>. Then, in people where this is effective, things reach a point where there is so much virus, that the body notices and moves on to take a more drastic approach. This is compatible with the virus killing older people more, as they have weaker immunes systems. This is however incompatible with the fact that people don't seem to be contagious after the viral phase is over...

= Why is COVID-19 so serious in some people but not in others?
{parent=COVID-19}

There are a few possibilities:
* <genetics>
  * bibliography:
    * https://www.science.org/doi/10.1126/scitranslmed.abj7521[] Identification of driver genes for critical forms of COVID-19 in a deeply phenotyped young patient cohort by Carapito et al. (2021)
* state of the immune system based on disease history
* age

= Why is COVID-19 more serious than the flu?
{parent=COVID-19}

= Severe acute respiratory syndrome coronavirus 2
{parent=COVID-19}

= SARS-CoV-2
{c}
{synonym}
{title2}

First sequenced variant: https://www.ncbi.nlm.nih.gov/genome/?term=86693

Genes at: https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3 TODO protein list on a database?

30kbp, 10 genes, 29 proteins: https://cen.acs.org/biological-chemistry/infectious-disease/know-novel-coronaviruss-29-proteins/98/web/2020/04

50-200 <nanometers> in <diameter>.

Gene overview:
* https://www.nature.com/articles/s41586-020-2286-9/figures/1
* https://www.ncbi.nlm.nih.gov/pmc/articles/PMC7138183/

= Variants of SARS-CoV-2
{parent=Severe acute respiratory syndrome coronavirus 2}
{wiki}

= SARS-CoV-2 cell entry
{c}
{parent=Severe acute respiratory syndrome coronavirus 2}

https://www.youtube.com/watch?v=6DxlkxA82FM COVID-19 Symposium: Entry of Coronavirus into Cells | Dr. Paul Bates

Interaction points:
* <ACE2>
* <TMPRSS2>

\Video[https://www.youtube.com/watch?v=e2Qi-hAXdJo]
{title=Model of Membrane Fusion by <SARS-CoV-2 S protein>[SARS CoV-2 Spike Protein] by <clarafi> (2020)}

= SARS-CoV-2 gene
{c}
{parent=Severe acute respiratory syndrome coronavirus 2}

Genes list: https://www.ncbi.nlm.nih.gov/nuccore/MN908947.3

Some are named after the encoded protein. Others that are not as clean are just orfXXX for <open reading frame> XXX.

= ORF1ab
{c}
{parent=SARS-CoV-2 gene}

Largest gene, <polyprotein> that contains <SARS-CoV-2 non-structural proteins> 1 to 11.

= SARS-CoV-2 protein
{c}
{parent=Severe acute respiratory syndrome coronavirus 2}

= SARS-CoV-2 structural protein
{c}
{parent=SARS-CoV-2 protein}

= SARS-CoV-2 E protein
{c}
{parent=SARS-CoV-2 structural protein}
{title2=envelope}

Envelope.

As shown at https://pubmed.ncbi.nlm.nih.gov/16877062/#&gid=article-figures&pid=fig-3-uid-2 has <transmembrane domain>.

= SARS-CoV-2 M protein
{c}
{parent=SARS-CoV-2 structural protein}
{title2=membrane}

Membrane.

As shown at https://pubmed.ncbi.nlm.nih.gov/16877062/#&gid=article-figures&pid=fig-3-uid-2 has <transmembrane domain>.

= SARS-CoV-2 S protein
{c}
{parent=SARS-CoV-2 structural protein}
{title2=spike}

Spike.

Nucleocapsid phosphoprotein, sticks to the <RNA> inside.

https://www.nature.com/articles/s41467-020-20768-y mentions functions:
* helps pack the viral RNA into the capsule
* also has a side function in immune suppression

= SARS-CoV-2 N protein
{c}
{parent=SARS-CoV-2 structural protein}

= SARS-CoV-2 non-structural protein
{c}
{parent=SARS-CoV-2 protein}

These are also required for test tube replication.

= SARS-CoV-2 Nsp3
{c}
{parent=SARS-CoV-2 non-structural protein}

Mentioned at: https://cen.acs.org/biological-chemistry/infectious-disease/know-novel-coronaviruss-29-proteins/98/web/2020/04

= SARS-CoV-2 Nsp5
{c}
{parent=SARS-CoV-2 non-structural protein}

<Protease> that cuts up <ORF1ab>. Note that it is also present in <ORF1ab>.

= SARS-CoV-2 Nsp12
{c}
{parent=SARS-CoV-2 non-structural protein}

The <RdRp>, since this is a <Positive-strand RNA virus>.

= SARS-CoV-2 accessory protein
{c}
{parent=SARS-CoV-2 protein}

Unlike <SARS-CoV-2 non-structural protein>, these are not needed for test tube reproduction. They must therefore be for host modulation.

= Dengue virus
{parent=Virus}
{wiki}

= Dengue
{synonym}

= Retrovirus
{parent=Virus}
{tag=Positive-strand RNA virus}
{wiki}

Integrates its <RNA> genome into the host genome.
* first RNA to DNA with <reverse transcriptase>
* then injects DNA into host genome with <integrase>

Sounds complicated! The advantage is likely as in <HIV>: once inside the cell, it can remain hidden far away from the cell surface, but still infections.

= Integrase
{parent=Retrovirus}
{tag=Enzyme}
{wiki}

= Reverse transcriptase
{parent=Retrovirus}
{tag=Enzyme}
{wiki}

Converts <RNA> to <DNA>, i.e. the inverse of <transcription (biology)>. Found in viruses such as <Retrovirus>, which includes e.g. <HIV>.

= HIV
{c}
{parent=Retrovirus}
{tag=Positive-strand RNA virus}
{wiki}

= AIDS
{c}
{parent=HIV}
{wiki}

= HIV vaccine
{c}
{parent=HIV}

* https://www.verywellhealth.com/hiv-vaccine-development-4057071

= Bacteria
{parent=Species}
{tag=Kingdom (biology)}
{tag=Prokaryote}
{wiki}

= Bacterial
{synonym}

= Bacterial cellular morphogology
{parent=Bacteria}
{wiki=Bacterial_cellular_morphologies}

= Bacterial cell structure
{parent=Bacteria}
{wiki}

= Bacterial cell wall
{parent=Bacterial cell structure}
{wiki=Cell_wall\#Bacterial_cell_walls}

The <cell wall> of a <bacteria>. Made of <peptidoglycan>, a <glycoprotein>.

= Bacterial conjugation
{parent=Bacteria}
{tag=Horizontal gene transfer}
{title2=bacterial sex}
{wiki}

Pseudo-<fuck>.

= Origin of transfer
{parent=Bacterial conjugation}
{wiki}

= Bacterial genome
{parent=Bacteria}
{wiki}

= Bacterial chromosome is circular
{parent=Bacterial genome}
{wiki}

= Gram stain
{c}
{parent=Bacteria}
{tag=Staining}
{wiki}

= Gram staining
{c}
{synonym}

= Gram-positive bacteria
{c}
{parent=Gram stain}
{wiki}

= Gram-negative bacteria
{c}
{parent=Gram stain}
{wiki}

Notable examples:
* <Escherichia coli>

\Image[https://upload.wikimedia.org/wikipedia/commons/8/8b/Gram_negative_cell_wall.svg]
{title=Structure of a <Gram-negative bacteria>}

= Bacterial outer membrane
{parent=Gram-negative bacteria}
{wiki}

Only present in <Gram-negative bacteria>.

\Image[https://upload.wikimedia.org/wikipedia/commons/8/8b/Gram_negative_cell_wall.svg]
{title=Structure of a <Gram-negative bacteria>}
{disambiguate=bacterial-outer-membrane}

= Periplasm
{parent=Bacterial outer membrane}
{wiki}

Space between the inner and <bacterial outer membrane> in <Gram-negative bacteria>

= List of bacteria
{c}
{parent=Bacteria}

= Escherichia coli
{c}
{parent=List of bacteria}
{tag=Gram-negative bacteria}
{tag=Model organism}

= E. Coli
{c}
{synonym}
{title2}

* https://www.cell.com/cell/fulltext/S0092-8674(15)00568-1 2015. Using Genome-scale Models to Predict Biological Capabilities. Edward J. O'Brien, Jonathan M. Monk, Bernhard O. Palsson.
* https://www.quora.com/What-are-some-good-books-on-Escherichia-Coli-E-Coli

Size: 1-2 micrometers long and about 0.25 micrometer in diameter, so: `2 * 0.5 * 0.5 * 10e-18` and thus 0.5 micrometer square.

Reference strain: <E. Coli K-12 MG1655>.

<Genome>:
* 4k <genes>
* 5 Mbps
* https://www.ncbi.nlm.nih.gov/genome/167
* `wget ftp://ftp.ncbi.nlm.nih.gov/genomes/all/GCF/000/005/845/GCF_000005845.2_ASM584v2/GCF_000005845.2_ASM584v2_genomic.fna.gz`
* `wget -O NC_000913.3.fasta 'https://www.ncbi.nlm.nih.gov/search/api/sequence/NC_000913.3/?report=fasta'`

Synthesis project: http://www.sciencemag.org/news/2016/08/biologists-are-close-reinventing-genetic-code-life

<Omics> modeling: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC5611438/ Tools for Genomic and Transcriptomic Analysis of Microbes at Single-Cell Level Zixi Chen, Lei Chen, Weiwen Zhang.

Bibliography:
* https://ecoliwiki.org/colipedia/index.php/Welcome_to_EcoliWiki

= E. Coli replication time
{c}
{parent=Escherichia coli}

20 minutes in optimal conditions, with a crazy multiple start sites mechanism: <E. Coli starts DNA replication before the previous one finished>.

Otherwise, naively, would take 60-90 minutes just to replicate and segregate the full DNA otherwise. So it starts copying multiple times.
* https://biology.stackexchange.com/questions/30080/how-can-e-coli-proliferate-so-rapidly
* http://stochasticscientist.blogspot.co.uk/2012/02/how-e-coli-grows-so-fast.html
* https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2063475/ Organization of sister origins and replisomes during multifork DNA replication in Escherichia coli by Fossum et al (2007)

= E. Coli starts DNA replication before the previous one finished
{c}
{parent=Escherichia coli}

Bibliography:
* https://biology.stackexchange.com/questions/30080/how-can-e-coli-proliferate-so-rapidly

= E. Coli origin of replication
{c}
{parent=Escherichia coli}

Appears to have just one, other <bacteria> can have more. TODO position in <NCBI>. Sequence determined in 1979: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC382992

<E. Coli K-12 MG1655 origin of replication>.

= E. Coli genome starting point
{c}
{parent=E. Coli origin of replication}

The conventional starting point is not at the <E. Coli K-12 MG1655 origin of replication>.

https://biocyc.org/ECOLI/NEW-IMAGE?type=EXTRAGENIC-SITE&object=G0-10506[] explains:
> This site is the origin of replication of the E. coli chromosome. It contains the binding sites for DnaA, which is critical for initiation of replication. Replication proceeds bidirectionally. For historical reasons, the numbering of E. coli's <circular chromosome> does not start at the <origin of replication>, but at the origin of transfer during conjugation.
If it is a bit hard to understand what they mean by "origin of transfer" though, as that term is usually associated with the <origin of transfer> of <bacterial conjugation>.

= E. Coli whole cell simulation
{c}
{parent=Escherichia coli}
{tag=Whole cell simulation}

\Include[e-coli-whole-cell-model-by-covert-lab]

= Multi-Omics Model and Analytics
{parent=E. Coli whole cell simulation}
{title2=MOMA}
{title2=2016}

By Tagkopoulos lab at <University of California, Davies>.

* https://www.nature.com/articles/ncomms13090 Multi-omics integration accurately predicts cellular state in unexplored conditions for Escherichia coli (2016)
* https://www.sciencedaily.com/releases/2016/10/161027173552.htm

= E. Coli Metabolome Database
{c}
{parent=Escherichia coli}

https://ecmdb.ca/

= E. Coli strain
{c}
{parent=Escherichia coli}

Reference strain: <E. Coli K-12 MG1655>.

= E. Coli K-12
{parent=E. Coli strain}

= E. Coli K-12 MG1655
{c}
{parent=E. Coli K-12}

<NCBI> taxonomy entry: https://www.ncbi.nlm.nih.gov/Taxonomy/Browser/wwwtax.cgi?id=511145 This links to:
* <genome>: https://www.ncbi.nlm.nih.gov/genome/?term=txid511145 From there there are links to either:
  * Download the <FASTA>: "Download sequences in FASTA format for genome, protein"

    For the genome, you get a compressed <FASTA> file with extension `.fna` called `GCF_000005845.2_ASM584v2_genomic.fna` that starts with:
    ``
    >NC_000913.3 Escherichia coli str. K-12 substr. MG1655, complete genome
    AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGCTTCTGAACTG
    ``

    Using <wc (unix)> as in `wc GCF_000005845.2_ASM584v2_genomic.fna` gives 58022 lines, in <Vim> we see that each line is 80 characters, except for the final one which is 52. So we have 58020 * 80 + 52 = 4641652 =~ 4.6 Mbp

  * Interactively browse the sequence on the browser viewer: "Reference genome: Escherichia coli str. K-12 substr. MG1655" which eventually leads to: https://www.ncbi.nlm.nih.gov/nuccore/556503834?report=graph

    If we zoom into the start, we hover over the very first <gene>/<protein>: the famous (just kidding) <e. Coli K-12 MG1655 gene thrL>, at position 190-255.

    The second one is the much more interesting <e. Coli K-12 MG1655 gene thrA>.
  * Gene list, with a total of 4,629 as of 2021: https://www.ncbi.nlm.nih.gov/gene/?term=txid511145

<KEGG> entry: https://www.genome.jp/pathway/eco01100+M00022

<BioCyc promoter database> query URL: https://biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI

= E. Coli K-12 MG1655 origin of replication
{c}
{parent=E. Coli K-12 MG1655}
{title2=3,925,744 - 3,925,975}

https://biocyc.org/ECOLI/NEW-IMAGE?type=EXTRAGENIC-SITE&object=G0-10506[]:

Note that this is not the conventional starting point for gene numbering: <E. Coli genome starting point>{full}.

= E. Coli K-12 MG1655 gene
{c}
{parent=E. Coli K-12 MG1655}

= E. Coli K-12 MG1655 gene thrL
{parent=E. Coli K-12 MG1655 gene}
{title2=190-255}
{title2=thr operon leader peptide}

<UniProt> entry: https://www.uniprot.org/uniprot/P0AD86[].

<NCBI> gene entry: https://www.ncbi.nlm.nih.gov/gene/944742[].

The first <gene> in the <E. Coli K-12 MG1655> genome. Remember however that <bacterial chromosome is circular>, so being the first doesn't mean much, how the choice was made: <E. Coli genome starting point>{full}.

Part of <E. Coli K-12 MG1655 operon thrLABC>.

At only 65 bp, this gene is quite small and boring. For a more interesting gene, have a look at the next gene, <e. Coli K-12 MG1655 gene thrA>.

Does something to do with <threonine>.

This is the first in the sequence thrL, thrA, thrB, thrC. This type of naming convention is quite common on related adjacent proteins, all of which must be getting <transcribed (biology)> into a single <RNA> by the same <promoter (genetics)>. As mentioned in the analysis of the <KEGG> entry for <e. Coli K-12 MG1655 gene thrA>, those A, B and C are actually directly functionally linked in a direct <metabolic pathway>.

We can see that thrL, A, B, and C are in the same <transcription unit> by browsing the list of <promoter (genetics)> at: https://biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI[]. By finding the first one by position we reach; https://biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486[].

= E. Coli K-12 MG1655 gene thrA
{parent=E. Coli K-12 MG1655 gene}
{tag=Enzyme}
{title2=337-2799}
{title2=fused aspartate kinase/homoserine dehydrogenase 1}

<UniProt> entry: https://www.uniprot.org/uniprot/P00561[].

<NCBI> entry: https://www.ncbi.nlm.nih.gov/gene/945803[].

The second <gene> in the <E. Coli K-12 MG1655> genome. Part of the <E. Coli K-12 MG1655 operon thrLABC>.

Part of a reaction that produces <threonine>.

This <protein> is an <enzyme>. The <UniProt> entry clearly shows the <chemical reactions> that it <catalyses>. In this case, there are actually two! It can either transforming the <metabolite>:
* "L-homoserine" into "L-aspartate 4-semialdehyde"
* "L-aspartate" into "4-phospho-L-aspartate"
Also interestingly, we see that both of those reaction require some extra energy to catalyse, one needing <adenosine triphosphate> and the other <nADP+>.

TODO: any mention of how much faster it makes the reaction, numerically?

Since this is an <enzyme>, it would also be interesting to have a quick search for it in the <KEGG> entry starting from the organism: https://www.genome.jp/pathway/eco01100+M00022 We type in the search bar "thrA", it gives a long list, but the last entry is our "thrA". Selecting it highlights two pathways in the large <graph>, so we understand that it catalyzes two different reactions, as suggested by the protein name itself (fused blah blah). We can now hover over:
* the <edge (graph)>: it shows all the enzymes that catalyze the given reaction. Both edges actually have multiple enzymes, e.g. the L-Homoserine path is also catalyzed by another enzyme called metL.
* the <node (graph)>: they are the <metabolites>, e.g. one of the paths contains "L-homoserine" on one node and "L-aspartate 4-semialdehyde"
Note that common <cofactor (biochemistry)> are omitted, since we've learnt from the UniProt entry that this reaction uses ATP.

If we can now click on the L-Homoserine edge, it takes us to: https://www.genome.jp/entry/eco:b0002+eco:b3940[]. Under "Pathway" we see an interesting looking pathway "Glycine, serine and threonine metabolism": https://www.genome.jp/pathway/eco00260+b0002 which contains a small manually selected and extremely clearly named subset of the larger graph!

But looking at the bottom of this subgraph (the UI is not great, can't Ctrl+F and enzyme names not shown, but the selected enzyme is slightly highlighted in red because it is in the URL https://www.genome.jp/pathway/eco00260+b0002[] vs https://www.genome.jp/pathway/eco00260[]) we clearly see that thrA, thrB and thrC for a sequence that directly transforms "L-aspartate 4-semialdehyde" into "Homoserine" to "O-Phospho-L-homoserine" and finally to<threonine>. This makes it crystal clear that they are not just located adjacently in the genome by chance: they are actually functionally related, and likely controlled by the same transcription factor: when you want one of them, you basically always want the three, because you must be are lacking <threonine>. TODO find transcription factor!

The UniProt entry also shows an interactive browser of the <tertiary structure> of the protein. We note that there are currently two sources available: <X-ray crystallography> and <AlphaFold>. To be honest, the <AlphaFold> one looks quite off!!!

By inspecting the <FASTA> for the entire genome, or by using the <NCBI open reading frame tool>, we see that this gene lies entirely in its own <open reading frame>, so it is quite boring

From the <FASTA> we see that the very first three <Codons> at position 337 are
``
ATG CGA GTG
``
where `ATG` is the <start codon>, and CGA GTG should be the first two that actually go into the protein:
* CGA: <arginine>
* GTG: <valine>

https://ecocyc.org/gene?orgid=ECOLI&id=ASPKINIHOMOSERDEHYDROGI-MONOMER[] mentions that the enzime is most active as <protein complex> with four copies of the same protein:
> Aspartate kinase I / homoserine dehydrogenase I comprises a <protein dimer>[dimer] of ThrA dimers. Although the dimeric form is catalytically active, the binding equilibrium dramatically favors the tetrameric form. The aspartate kinase and homoserine dehydrogenase activities of each ThrA monomer are catalyzed by independent domains connected by a linker region.
TODO image?

= E. Coli K-12 MG1655 gene thrB
{parent=E. Coli K-12 MG1655 gene}
{title2=2,801 - 3,733}

Immediately follows <e. Coli K-12 MG1655 gene thrA>,

Part of <E. Coli K-12 MG1655 operon thrLABC>.

= E. Coli K-12 MG1655 gene thrC
{parent=E. Coli K-12 MG1655 gene}

Part of <E. Coli K-12 MG1655 operon thrLABC>.

= E. Coli K-12 MG1655 gene yaaX
{parent=E. Coli K-12 MG1655 gene}
{title2=5,234 - 5,530}

The fifth gene, and the first <E. Coli K-12 MG1655 gene of unknown function> as of 2021.

* https://www.uniprot.org/uniprot/P75616
* https://www.ncbi.nlm.nih.gov/gene/944747

= E. Coli K-12 MG1655 gene dksA
{parent=E. Coli K-12 MG1655 gene}
{title2=160,604 - 160,149}

* https://www.uniprot.org/uniprot/P0ABS1
* https://www.ncbi.nlm.nih.gov/gene/944850

= E. Coli K-12 MG1655 gene lrp
{parent=E. Coli K-12 MG1655 gene}
{title2=932,595 - 933,089}

https://biocyc.org/gene?orgid=ECOLI&id=EG10547

= E. Coli K-12 MG1655 gene fnr
{parent=E. Coli K-12 MG1655 gene}
{title2=1,398,774 - 1,399,526}

Transcription factor for <E. Coli K-12 MG1655 operon thrLABC> as shown at https://biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486[].

= E. Coli K-12 MG1655 gene arcA
{parent=E. Coli K-12 MG1655 gene}
{title2=4,639,590 - 4,640,306}

Transcription factor for <E. Coli K-12 MG1655 operon thrLABC> as shown at https://biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486[].

Note that this is very close to the "end" of the genome.

<NCBI>: https://www.ncbi.nlm.nih.gov/gene/948874

<UniProt>: https://www.uniprot.org/uniprot/P0A9Q1

TODO DNA assembly structure.

= E. Coli K-12 MG1655 gene ytdX
{parent=E. Coli K-12 MG1655 gene}
{title2=5,234 - 5,530}

The "last" gene, and also an <E. Coli K-12 MG1655 gene of unknown function>.

= E. Coli K-12 MG1655 gene of unknown function
{c}
{parent=E. Coli K-12 MG1655}

All <gene> names that start with an <Y> such as:
* <e. Coli K-12 MG1655 gene ytdX>
* <e. Coli K-12 MG1655 gene yaaX>
appear to be <proteins of unknown function>.

<UniProt> for example describes YaaX as "Uncharacterized protein YaaX".

As function is discovered, they then change it to a better name, e.g. to names such as the <E. Coli K-12 MG1655 transcription unit thrLABC> proteins all of which have a clear name due to <threonine>.

There are many other `y???` as of 2021! Though they do tend to be smaller <molecules>.

= E. Coli K-12 MG1655 promoter
{c}
{parent=E. Coli K-12 MG1655}

https://biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI

From this we see that there is a convention of naming promoters as <protein> name + <P>[p], e.g. the first <gene> in <E. Coli K-12 MG1655 promoter thrLp> encodes protein `thrL`.

It is also possible to add numbers after the `p`, e.g. at https://biocyc.org/ECOLI/NEW-IMAGE?type=OPERON&object=PM0-45989 we see that the protein `zur` has two promoters:
* `zurp6`
* `zurp7`
TODO why 6 and 7? There don't appear to be 1, 2, etc.

= E. Coli K-12 MG1655 promoter thrLp
{c}
{parent=E. Coli K-12 MG1655 promoter}
{title2=148}

<promoter> for the <E. Coli K-12 MG1655 operon thrLABC>.

= E. Coli K-12 MG1655 operon thrLABC
{c}
{parent=E. Coli K-12 MG1655 promoter thrLp}

Contains the <genes>: <e. Coli K-12 MG1655 gene thrL>, <e. Coli K-12 MG1655 gene thrA>, <e. Coli K-12 MG1655 gene thrB> and <e. Coli K-12 MG1655 gene thrC>, all of which have directly linked functionality.

We can find it by searching for the species in the <BioCyc promoter database>. This leads to: https://biocyc.org/group?id=:ALL-PROMOTERS&orgid=ECOLI[].

By finding the first <operon> by position we reach: https://biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486[].

That page lists several components of the promoter, which we should try to understand!

Some of the <transcription factors> are <proteins>:
* <e. Coli K-12 MG1655 gene arcA>
* <e. Coli K-12 MG1655 gene fnr>
* <e. Coli K-12 MG1655 gene dksA>
* <e. Coli K-12 MG1655 gene lrp>

After the first gene in the codon, thrL, there is a <rho-independent termination>. By comparing:
* https://biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486
* https://biocyc.org/ECOLI/NEW-IMAGE?object=TU00178
we understand that the presence of <threonine> or <isoleucine> variants, L-threonyl and L-isoleucyl, makes the <rho-independent termination> become more efficient, so the control loop is quite direct! Not sure why it cares about <isoleucine> as well though.

TODO which factor is actually specific to that DNA region?

= E. Coli K-12 MG1655 transcription unit thrL
{c}
{parent=E. Coli K-12 MG1655 promoter thrLp}

Contains the <gene>: <e. Coli K-12 MG1655 gene thrL>.

https://biocyc.org/ECOLI/NEW-IMAGE?object=TU0-42486

Subset of the longer <E. Coli K-12 MG1655 transcription unit thrLABC>.

= E. Coli K-12 MG1655 transcription unit thrLABC
{c}
{parent=E. Coli K-12 MG1655 promoter thrLp}

Contains the <genes>: <e. Coli K-12 MG1655 gene thrL>, <e. Coli K-12 MG1655 gene thrA>, <e. Coli K-12 MG1655 gene thrB> and <e. Coli K-12 MG1655 gene thrC>.

https://biocyc.org/ECOLI/NEW-IMAGE?object=TU00178

= Mycoplasma
{parent=List of bacteria}
{tag=Genus}
{wiki}

Maybe the most famous one is <Mycoplasma genitalium> byt there are others, and notably with lower biosafety levels:
* <Biosafety level> 1: https://www.lgcstandards-atcc.org/Search_Results.aspx?dsNav=Ntk:PrimarySearch%7cmycoplasma%7c3%7c,Ny:True,N:1000552-1000577-4294967226&searchTerms=mycoplasma&redir=1

= Mycoplasma genitalium
{c}
{parent=Mycoplasma}
{tag=Systems biology}
{wiki}

= M. genitalium
{c}
{synonym}
{title2}

https://www.lgcstandards-atcc.org/products/all/49896.aspx[]:
* £355.00 in 2019
* <biosafety level>: 2

Size: 300 x 600 nm

Reproduction time: https://www.quora.com/unanswered/How-long-do-Mycoplasma-bacteria-take-to-reproduce-under-optimal-conditions

Has one of the smallest genomes known, and <JCVI> made a minimized strain with 473 genes: <JCVI-syn3.0>.

The reason why genitalium has such a small genome is that <parasites tend to have smaller DNAs>. So it must be highlighted that genitalium can only survive in highly enriched environments, it can't even make its own <amino acids>, which it normally obtains fromthe host cells! And because it cannot do <cellular respiration>, it very likely replicates slower than say <E. Coli>. It's easy to be small in such scenarios!

<Power, Sex, Suicide by Nick Lane (2006)> section "How to lose the cell wall without dying" page 184 has some related mentions puts it well very:
> One group, the Mycoplasma, comprises mostly parasites, many of which live inside other cells. Mycoplasma cells are tiny, with very small genomes. <M. genitalium>, discovered in 1981, has the smallest known genome of any bacterial cell, encoding fewer than  genes. Despite its simplicity, it ranks among the most common of sexually transmitted diseases, producing symptoms similar to Chlamydia infection. It is so small (less than a third of a micron in diameter, or an order of magnitude smaller than most bacteria) that it must normally be viewed under the <electron microscope>; and difficulties culturing it meant its significance was not appreciated until the important advances in gene sequencing in the early 1990s. Like Rickettsia, Mycoplasma have lost virtually all the genes required for making <nucleotides>, <amino acids>, and so forth. Unlike Rickettsia, however, Mycoplasma have also lost all the genes for oxygen respiration, or indeed any other form of membrane respiration: they have no cytochromes, and so must rely on <fermentation> for energy.

Downsides mentioned at https://youtu.be/PSDd3oHj548?t=293[]:
* too small to see on light microscope
* difficult to genetically manipulate. TODO why?
* less literature than <E. Coli>.

Data:
* https://www.ncbi.nlm.nih.gov/bioproject/97 contains genome, genes, proteins.
* http://www.genome.jp/kegg-bin/show_pathway?mge01100 all known pathways. TODO: numerical reaction coefficients? Which enzyimes mediate what? Appears to factor pathways across organisms, which is awesome.

= M. genitalium whole cell simulation
{c}
{parent=Mycoplasma genitalium}
{tag=Whole cell simulation}

= Lattice Microbes
{c}
{parent=M. genitalium whole cell simulation}
{title2=2022}

<GPU> accelerated, simulates the Craig's minimized <M. genitalium>, <JCVI-syn3A> at a particle basis of some kind.

Lab head is the cutest-looking lady ever: https://chemistry.illinois.edu/zan[], Zaida (Zan) Luthey-Schulten.

* 2022 paper: https://www.cell.com/cell/fulltext/S0092-8674(21)01488-4 Fundamental behaviors emerge from simulations of a living minimal cell by Thornburg et al. (2022) published on <Cell (journal)>
* http://faculty.scs.illinois.edu/schulten/lm/ actual source code. No <Version control> and non-<code drop> release, openess and best practices haven't reached such far obscure reaches of academia yet. One day.
* https://blogs.nvidia.com/blog/2022/01/20/living-cell-simulation/ <Nvidia> announcement. That's how they do business, it is quite interesting how they highlight this kind of research.
  * https://catalog.ngc.nvidia.com/orgs/hpc/containers/lattice-microbes has a container

= M. genitalium whole cell model by Covert lab
{c}
{parent=M. genitalium whole cell simulation}

https://simtk.org/projects/wholecell

http://www.wholecell.org/

https://github.com/CovertLab/WholeCell Arghh, <MATLAB>. https://github.com/CovertLab/WholeCellSimDB

http://www.wholecellviz.org/viz.php awesome visualization of simtk, paper: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3413483/ A Whole-Cell Computational Model Predicts Phenotype from Genotype - 2013 - Jonathan R. Karr.

Followed up by the <E. Coli Whole Cell Model by Covert Lab>.

= Mycoplasma mycoides
{c}
{parent=Mycoplasma}
{wiki}

= M. mycoides
{c}
{synonym}

= M. mycoides strain
{c}
{parent=Mycoplasma mycoides}

= M. mycoides JCVI strain
{c}
{parent=M. mycoides strain}

https://www.newyorker.com/magazine/2022/03/07/a-journey-to-the-center-of-our-cells A Journey to the Center of Our Cells (2022) by <James Somers> comments on <M. genitalium> in general, and in particular on the JCVI strains.

= JCVI-syn3A
{c}
{parent=M. mycoides JCVI strain}
{title2=2019}

<essential metabolism for a minimal cell (2019)> mentions:
> JCVI-syn3A, a robust minimal cell with a 543 kbp genome and 493 genes, provides a versatile platform to study the basics of life.

<NCBI>: https://www.ncbi.nlm.nih.gov/nuccore/CP016816.2

Based on <JCVI-syn3.0>, they've added a few genes back to give better <phenotypes>, including slightly faster duplication time. Because <the development cycle time is your God> is also true in biology.

As of <essential metabolism for a minimal cell (2019)> it had only 91 genes of unknown function! So funny.

Bibliograpy:

\Image[https://web.archive.org/web/20220530091157if_/https://cdn.rcsb.org/pdb101/goodsell/png-800/jcvi-syn3a-minimal-cell.png]
{title=<JCVI-syn3A> during <cell division> by <David Goodsell> (2022)}
{description=A description is present at: https://cdn.rcsb.org/pdb101/goodsell/2022_JCVI-syn3A.pdf Integrative Illustration of a JCVI-syn3A Minimal Cell by <David Goodsell> (2022) which describes everything in the picture.}
{source=https://pdb101.rcsb.org/sci-art/goodsell-gallery/jcvi-syn3a-minimal-cell}

= Essential metabolism for a minimal cell (2019)
{parent=JCVI-syn3A}

https://elifesciences.org/articles/36842

= JCVI-syn3.0
{c}
{parent=M. mycoides JCVI strain}
{title2=2016}

<essential metabolism for a minimal cell (2019)> mentions:
* <NCBI>: https://www.ncbi.nlm.nih.gov/nuccore/CP014940.1
* 473 genes

http://phenomena.nationalgeographic.com/2016/04/21/we-built-the-worlds-simplest-cell-but-dunno-how-it-works/ likely talks about it.

Stuff built on top:
* https://www.scientificamerican.com/article/scientists-create-the-smallest-ever-moving-cell/ 7-8 movement genes

= JCVI-syn3B
{c}
{parent=M. mycoides JCVI strain}
{title2=2022}

https://www.biorxiv.org/content/10.1101/2022.09.19.508583v1.full
> CVI-syn3B strains differ from <JCVI-syn3.0> by the presence of 19 additional non-essential genes that result in a more easily manipulated cell. JCVI-syn3B additionally includes a dual loxP landing pad that enables easy Cre recombinase mediated insertion of genes
It is also interesting to see how they are interested in co-culture with <HeLa> cells, presumably to enable infectious bacterial disease studies.

At https://biology.indiana.edu/news-events/news/2023/lennon-minimal-cells.html (2023) they let it re-evove to it it would regain some fitness, and it did.

= Arkarya
{parent=Species}
{wiki}

Name of the <clade> of <archaea> plus <eukarya> proposed at: https://www.frontiersin.org/articles/10.3389/fmicb.2015.00717/full[]. Much better term than <prokaryote> as that is not a <clade>. Let's hope it catches on!

= Archaea
{parent=Arkarya}
{tag=Kingdom (biology)}
{tag=Prokaryote}
{wiki}

= Archaea are more cosely related to the eukaryotes than bacteria
{parent=Archaea}

<Archaea> are much more closely related to the <eukaryotes> than <bacteria>, see e.g. <image Coral of life by János Podani (2019)> which shows how <archaea> diverged from eukarya almost 2 By after <LUCA>!

It therefore appears that the <mitochondrial endosymbiosis> happened when a <bacteria> like cell joined up with an <archaea>.

Some notable points in which <archaea> look more like <eukaryotes> than <bacteria>:
* although they don't have a <cell nucleus>, they do have <histones>! Mentioned at:
  * <Power, Sex, Suicide by Nick Lane (2006)>
  * https://www.pnas.org/doi/10.1073/pnas.94.23.12633

= Eukaryote
{parent=Species}
{tag=Domain (biology)}
{wiki}

= Eukarya
{synonym}

= Eukaryotic
{synonym}

= Advantage of eukaryote over bacteria
{parent=Eukaryote}
{wiki}

= Eukaryotes can do phagocytosis due to their cytoskeleton
{parent=Advantage of eukaryote over bacteria}

= Eukaryotes can do phatocytosis due to their cytoskeleton
{synonym}

<Power, Sex, Suicide by Nick Lane (2006)> page 53 suggests that one tremendous advantage of <eukaryotes> over <bacteria> is their ability to change shape due to the presence of the <cytoskeleton>, and the lack of a rigid <bacterial cell wall>.

Imagine in a world where there are only <bacteria>, and you can eat entire bacteria in one go, what a huge advantage that is!

= Amoeba
{parent=Eukaryote}
{tag=Paraphyletic subgroup}
{wiki}

This group is a mess.

But one thing you should really know, as often mentioned in <Power, Sex, Suicide by Nick Lane (2006)>: they are all <eukaryotes>.

Because <prokaryotes> are fundamentally unable to do <phagocytosis>, because they have a rigid <cell wall>. Changing cell shape at will requires a <cytoskeleton>.

= Eukarya subclade
{parent=Eukaryote}
{wiki}

= Animal
{parent=Eukarya subclade}
{tag=Kingdom (biology)}
{wiki}

= Animalia
{synonym}

Formal name: "animalia".

List of <animal> <class (biology)>: https://en.wikipedia.org/wiki/List_of_animal_classes

= Animal anatomy
{parent=Animal}

= Anus
{parent=Animal anatomy}
{wiki}

= Cloaca
{parent=Animal anatomy}
{wiki}

A single hole that is used for <shit>, <pee> and <fucking>. Amazing.

= Animal flight
{parent=Animal}
{wiki}

= Warm-blooded
{parent=Animal}
{wiki}

= Homeothermy
{parent=Warm-blooded}
{wiki}

It is quite <mind blowing> that this is <polyphyletic> on <mammals> and <birds>, what can't <parallel evolution> achieve??

\Image[https://upload.wikimedia.org/wikipedia/commons/2/23/Phylogenetic-Groups.svg]
{title=<Phylogenetic tree> of the <vertebrates>}
{description=Highlights how <birds> should obviously be classified as <reptiles>.}

= Animal subclade
{parent=Animal}
{wiki}

Good <phylogenetic tree> as usual: https://en.wikipedia.org/w/index.php?title=Animal&oldid=1053478004#Phylogeny

= Placozoan
{parent=Animal subclade}
{wiki}

Now that's some basal shit! It's basically a fucking blob!!! Except that it is flat. No <nervous system>. Not even <tissues>. It is basically a multicellular 

\Image[https://upload.wikimedia.org/wikipedia/commons/thumb/3/38/Trichoplax_adhaerens_photograph.png/898px-Trichoplax_adhaerens_photograph.png]

= Panarthropoda
{parent=Animal subclade}
{wiki}

A bunch of things that looks like insects, notably <arthropods> and <tardigrades>.

= Panarthropoda subclade
{parent=Panarthropoda}

= Arthropod
{parent=Panarthropoda subclade}
{wiki}

= Drosophila melanogaster
{c}
{parent=Arthropod}
{title2=Common fruit fly}
{wiki}

= D. melanogaster
{c}
{synonym}

= Fruit fly
{synonym}
{title2}

= Fruit fly model
{parent=Drosophila melanogaster}

= NeuroMechFly
{c}
{parent=Fruit fly model}
{title2=2021}

* https://github.com/NeLy-EPFL/NeuroMechFly
* https://www.nature.com/articles/s41592-022-01466-7

Just imagine this together with a <Drosophila connectome> on a single <brain-in-the-loop> simulation.

\Image[https://web.archive.org/web/20230302220755im_/https://github.com/NeLy-EPFL/NeuroMechFly/raw/main/docs/images/perturbation.gif]
{source=https://github.com/NeLy-EPFL/NeuroMechFly}

= DeepMind fuite fly
{c}
{parent=Fruit fly model}
{tag=Deepmind project}
{title2=2024}

They didn't give the thing a name, so we're calling it the "DeepMind fuit fly" for now.

Together with <Janelia Research Campus>.

Paper: https://www.biorxiv.org/content/10.1101/2024.03.11.584515v1 Whole-body simulation of realistic fruit fly locomotion with deep reinforcement learning (2024)

Using <MuJoCo>.

\Video[https://www.youtube.com/watch?v=tz9GPsyL1rs]
{title=Artificial intelligence brings a virtual fly to life by HHMI's Janelia Research Campus}

= Tardigrade
{parent=Panarthropoda subclade}
{title2=Indestructible insect-like}
{title2=Water bear}
{wiki}

\Video[https://www.youtube.com/watch?v=zV2wIfDzFMk]
{title=We FINALLY Understand Why Tardigrades Refuse to Die by Dr Ben Miles}

= Chordate
{parent=Animal subclade}
{wiki}

Chordate is a sad clade.

You read the name and think: hmm, neural cords!

But then you see that his is one of its members:

\Image[https://upload.wikimedia.org/wikipedia/commons/thumb/c/cd/Tunicate_komodo.jpg/1024px-Tunicate_komodo.jpg]

Yup. That's your cousin. And it's a much closer cousin than something like <arthropods>, which at least have heads eyes and legs like you.

<Convergent evolution> is crazy!

= Chordate subclade
{parent=Chordate}
{wiki}

= Lancelet
{parent=Chordate subclade}
{wiki}

\Image[https://upload.wikimedia.org/wikipedia/commons/4/47/Branchiostoma_lanceolatum.jpg]

= Vertebrate
{parent=Chordate subclade}
{wiki}

The big breakthrough of the vertebrates appears to be the ability to swim around in a straight line and eat smaller species that are floating about.

<Bones> appear to help that a lot!

It is likely the most efficient design to travel long distances. Be thin and wiggle your tail around.

Perhaps smaller <animals> can skip the bone thing. Maybe a notable example are the <lancelets>, which look a bit like small fish. But they only go up to 8 cm.

= Vertebrate subclade
{parent=Vertebrate}

= Fish
{parent=Vertebrate}
{tag=Paraphyletic subgroup}
{wiki}

<Vertebrates> minus <tetrapods>.

This paraphyletic subgroup is easy to form the "acquatic only" (fishes) vs "things that come out of water" (<tetrapods>). Though <mudfishes> make that distinction harder.

Which kind of makes sense, why would you want for limbs unless you are going to stay out of water!

= Mudfish
{parent=Fish}
{wiki}

= Zebrafish
{parent=Fish}
{tag=Model organism}
{wiki}

= Danio rerio
{c}
{synonym}
{title2}

= Fish subclade
{parent=Fish}

Once Ciro joked in a <twenty questions>-like game that humans are <animals>.

But counting humans a <fish> would have been a stroke of genius.

= Tetrapod
{parent=Fish subclade}
{wiki}

Includes:
* <amphibians>
* <amniotes>, which includes:
  * <sauropsida>: <reptiles> and <birds>, which really are reptiles
  * <mammals>

The exact relationships between those clades is not very clear as there's a bunch of <extinct> species in the middle we are not sure exactly where they go exactly, some hypothesis are listed at: https://en.wikipedia.org/w/index.php?title=Tetrapod&oldid=1053601110#Temnospondyl_hypothesis_(TH)

But at least it seems rock solid that those three are actually clades.

= Tetrapod subclade
{parent=Tetrapod}
{wiki}

= Amphibian
{parent=Tetrapod subclade}
{wiki}

= Amniote
{parent=Tetrapod subclade}
{wiki}

Name origin: <amnion>, a pellicle that covers embryos of both <eggs> and also during <pregnancy>.

Includes:
* <sauropsida>: <reptiles> and <birds>, which really are reptiles
* <mammals>, or if you want to include a bunch of extinct non-reptile mammal ancestors, <synapsids>.

Does not include <amphibians>. If you include them, you have the <tetrapods>.

= Amnion
{parent=Amniote}
{wiki}

= Amniote subclade
{parent=Amniote}

= Sauropsida
{parent=Amniote subclade}
{wiki}

= Reptile
{parent=Sauropsida}

This being a <class (biology)> is <bullshit> because it is not a <clade>, notably <birds> are not considered reptiles, but they are clearly in the clade.

= Sauropsida subclade
{parent=Sauropsida}

= Bird
{parent=Sauropsida subclade}
{wiki}

= Aves
{synonym}

= Crow
{parent=Bird}
{wiki}

= Synapsid
{parent=Amniote subclade}
{title2=Mammals + extinct reptile like cousins}
{wiki}

<Mammals> and a bunch of <extinct> animals that look more like mammals than <reptiles>.

TODO name: Wikipedia says "being with a fused arch" but what does that mean???

= Synapsid subclade
{parent=Synapsid}

= Mammal
{parent=Synapsid subclade}
{wiki}

Good <phylogenetic tree>: https://en.wikipedia.org/w/index.php?title=Mammal&oldid=1052295685#Molecular_classification_of_placentals

= Milk
{parent=Mammal}
{wiki}

= Mammal subclade
{parent=Mammal}

= Monotreme
{parent=Mammal subclade}
{title2=Mammals that lay eggs}
{wiki}

The weirdest <mammal> <clade>: they lay fucking <eggs>. Only 5 known species alive as of 2020.

Eggs are <basal (phylogenetics)>: they simply didn't evolve out of what other <reptiles> do. From which we conclude that <milk> came before <eggs> stopped.

So this is the most basal subclade of mammals.

Etymology: means "single hole" in <Greek (language)>, because like other <reptiles> it has a single hole for <shit>, <pee> and <fucking>: the <cloaca>.

= Theria
{parent=Mammal subclade}
{title2=Mammals that don't lay eggs}
{title2=wild beast}
{wiki}

Every mammal except the weird <monotremes>, i.e. <marsupials> and the <placentalia>.

The name is completely random, "wild beast". Are platypuses not "wild beasts"? They have a freaking poison!!

= Theria subclade
{parent=Theria}

= Marsupial
{parent=Theria subclade}
{wiki}

They split up from the rest of the <mammals> after the <monotremes>.

Every other mammal has a <placenta>.

This baby in pouch thing just feels like a pre-<placenta> stage.

= Placentalia
{parent=Theria subclade}
{wiki}

= Placenta
{parent=Placentalia}
{tag=Animal anatomy}
{wiki}

= Placentalia subclade
{parent=Placentalia}

= Bat
{parent=Placentalia subclade}
{wiki}

As of 2020, account for about 20% of the known <mammal> species!!! https://www.sciencefocus.com/nature/why-are-there-so-many-species-of-bat/ mentions some reasons:
* they can fly, so they can move out further
* their eating habits are highly specialized

= Euarchontoglires
{parent=Placentalia subclade}
{wiki}

<Mice>, #rabbits and <primates>.

= Euarchontoglires subclade
{parent=Euarchontoglires}

= Mouse
{parent=Euarchontoglires subclade}
{wiki}

= Rat
{parent=Mouse}
{wiki}

Since <rat> and <mouse> are not scientifically specific names, we'll just use them interchangeably.

When one specific species is implied, we will mean <Mus musculus> by default.

= House mouse
{parent=Mouse}
{tag=Model organism}
{wiki}

= Mus musculus
{c}
{synonym}
{title2}

= Mouse mutant
{parent=House mouse}

Exciting... sometimes cruel. But too exciting not to do:
* 2016 https://nextnature.net/story/2016/reversing-evolution-legless-mouse limbless

Databases and projects:
* https://www.jax.org/research-and-faculty/resources/mouse-mutant-resource The Jackson Laboratory

= Genetically modified mouse
{parent=Mouse mutant}
{wiki}

= Knockout mouse
{parent=Mouse mutant}
{wiki}

Databases and projects:
* https://www.ncbi.nlm.nih.gov/pmc/articles/PMC2716027/ The Knockout Mouse Project (2004)

= Primate
{parent=Euarchontoglires subclade}
{wiki}

= Primate subclade
{parent=Primate}

= Simian
{parent=Primate subclade}
{wiki}

= Simian subclade
{parent=Simian}

= Ape
{parent=Simian subclade}
{wiki}

= Hominoidea
{synonym}
{title2}

= Ape subclade
{parent=Ape}

= Australopithecine
{parent=Ape subclade}
{title2=7.3 Mya}

This is the level at which <human> and all <extinct> siblings lie, with no other <extant> species, all others were killed or fucked to death: <interbreeding between archaic and modern humans>{full}.

Good <cladogram>: https://en.wikipedia.org/w/index.php?title=Homo&oldid=1155900663#Phylogeny

\Include[human]{parent=Australopithecine}

= Laurasiatheria
{parent=Placentalia subclade}
{wiki}

<Carnivora>[Carnivores], <ungulates>, hedgehogs.

= Laurasiatheria subclade
{parent=Laurasiatheria}

= Carnivora
{parent=Laurasiatheria subclade}
{title2=Cats, dogs, bears, seals}
{wiki}

= Carnivora subclade
{parent=Carnivora}

= Bear
{parent=Carnivora subclade}

= Ungulate
{parent=Laurasiatheria subclade}
{title2=Cows, pigs, whales}
{wiki}

= Ungulate subclade
{parent=Ungulate}

= Cow
{parent=Ungulate subclade}

= Nematode
{parent=Animal subclade}
{wiki}

= Caenorhabditis elegans
{c}
{parent=Nematode}
{tag=Model organism}
{wiki}

= C. elegans
{c}
{synonym}
{title2}

* https://www.cell.com/cell-systems/fulltext/S2405-4712(16)30120-X
* https://www.cell.com/cell-systems/fulltext/S2405-4712(16)30151-X A Genome-Scale Database and Reconstruction of Caenorhabditis elegans Metabolism Gebauer, Juliane et al. Cell Systems , Volume 2 , Issue 5 , 312 - 322

= C. elegans cell lineage
{parent=Caenorhabditis elegans}
{tag=Cell lineage}

Exactly 1033 <somatic cells> on male, 959 on hermaphrodite, every time, counted as of 2020. A beauty.

Exactly 131 commit <apoptosis> in the hermaphrodite.

https://www.wormatlas.org/celllineages.html contains the full lineage as some huge and impossible to view images. This image was taken directly from <The embryonic cell lineage of the nematode Caenorhabditis elegans> where it is split across many pages, it is a thing of beauty on the PDF.

https://www.wormatlas.org/celllistsulston.htm contains a non-hierarchical table with the cells and their names.

= C. elegans body system
{c}
{parent=Caenorhabditis elegans}

= C. elegans models and databases
{c}
{parent=Caenorhabditis elegans}
{tag=Biology database}

= WormAtlas
{c}
{parent=C. elegans models and databases}
{wiki}

A collection of closely related and curated <C. elegans> datasets.

= WormWiring
{c}
{parent=WormAtlas}

https://wormwiring.org/

This contains the <C. elegans> connectome.

The browseable thing is this massive interactive <PDF>: https://wormwiring.org/papers/Interactive-Diagram.pdf[]. It lists <neurons> from the <C. elegans cell lineage> using the standard cell names, and how they connect to each other. Some make a surprising ammount of connections.

\Image[https://web.archive.org/web/20230921024845im_/https://wormwiring.org/art1/connectome_small.PNG]
{height=1200}

= SlidableWorm
{c}
{parent=WormAtlas}

https://www.wormatlas.org/SW/SW.php/index_html5.html

Fantastic resouce that contains cross sections of <C. elegans> at various lengths of its body. Presumably frozen and cut with a <Microtome> and then scanned with <electron microscopy>.

Shame that there are so many parts missing.

It's the <Visible Human Project>, but for <C. elegans>!

= WormBase
{c}
{parent=C. elegans models and databases}
{wiki}

https://wormbase.org//#012-34-5

TODO what does it contain. Does it have <metabolic pathways>?

= Virtual Worm Project
{c}
{parent=WormBase}

http://caltech.wormbase.org/virtualworm/

This one has a 3D model of <C. elegans> containing all the cells, browsable on the browser at: http://browser.openworm.org/[].

\Image[https://web.archive.org/web/20240928210212im_/http://caltech.wormbase.org/virtualworm/Images/OpenWormBrowser3.png]
{height=800}

= WormWideWeb
{c}
{parent=C. elegans models and databases}
{title2=2023}
{wiki}

https://wormwideweb.org/
> Browse freely moving whole-brain calcium imaging datasets

= OpenWorm
{c}
{parent=Caenorhabditis elegans}
{tag=Organism model}
{wiki}

https://openworm.org

<Whole organism simulation> of <C. elegans>.

High level simulation only, no way to get from <DNA> to worm! :-) Includes:
* <nervous system>
* muscle system

3D body viewer at: http://browser.openworm.org/ TODO can you click on a cell to get its name?

\Video[https://www.youtube.com/watch?v=SaovWiZJUWY]
{title=<OpenWorm> Sibernetic demo by Mike Vella (2013)}
{description=Sibernetic adds a <fluid dynamics> solver for <brain-in-the-loop> simulation of <C. elegans>.}

= Fungus
{parent=Eukarya subclade}
{tag=Kingdom (biology)}
{wiki}

= Fungi
{synonym}

Formal name: "fungi".

= Mold
{parent=Fungus}
{wiki}

= Yeast
{parent=Fungus}

Does not appear to refer to any one specific <phylogenetic tree>[phylogenetic] level, it usually refers to either:
* <Saccharomyces cerevisiae>, the model <eukaryote> <unicellular organism>
* two phila of the <fungus> <kingdom (biology)>

= Saccharomyces cerevisiae
{c}
{parent=Fungus}
{tag=Systems biology}
{wiki}

= S. cerevisiae
{c}
{synonym}
{title2}

Size: 10 micrometers.

Genome:
* 12 <base pair>[Mbps]
* 6k <genes>
* databases: https://en.wikipedia.org/wiki/Saccharomyces_Genome_Database | https://www.yeastgenome.org/ Includes:
  * known pathways: https://pathway.yeastgenome.org/overviewsWeb/celOv.shtml
* https://www.ncbi.nlm.nih.gov/genome?term=saccharomyces%20cerevisiae

<Proteins> per cell: 42m: https://www.cell.com/pb-assets/journals/research/cell-systems/cels_384.pdf

Division time: 100 minutes.

Minimization project: https://en.wikipedia.org/wiki/Saccharomyces_cerevisiae#Synthetic_yeast_genome_project | http://syntheticyeast.org/

= Plant
{parent=Eukarya subclade}
{tag=Kingdom (biology)}
{wiki}

Formal name: "plantae".

= Borlotti beans
{parent=Plant}
{wiki=Cranberry_bean}

This looks a lot like the beans that <Brazilians> venerate and can be easily found in the <United Kingdom> as of 2020.

The more exact type seems to be <pinto bean>, but this is close enough.

2021-03: same but 2.5 teaspons, seems to be the right ammount.

2021-02-10: attempt 3: 500g 1 hour 30 minutes no pressure, uncontrolled water. Salt with one chorizo: put 3 teaspoons, it was a bit too much, going to do 2 next time and see.

2020-12-14: attempt 3: 250g of beans, 1.5l of water, 30 minutes pressure.

2020-11-30: attempt 2: 275ml of dry beans, about 50% of 500g bag, putting 1650 ml (6x) of water on pressure cooker Still had to throw out some water.

Density dry raw: 216 g/250 ml = 432 g / 500 ml = 500 g / 580 ml = 864 g/L

500 g dry expands to in water after 12 hours: 1200 ml

Therefore 500 g dry = 864 / 2 L = 432 ml expands about 3x.

Therefore, to the maximum 2.5L of the cooker with 8x https://www.oliviascuisine.com/brazilian-style-beans/[dry volume water from this recipe] I can use:
``
2500 = volume expanded bean + volume water = 3 volume dry bean + 8 volume dry bean = 11 volume dry bean
``
and so:
``
volume dry bean = 2500/11 = 227ml
``
which is about 227 / 580 = 40% of the 500 g bag.

After first try, I found that 8x volume of water is way, way too much. Going to try 6x next time.

= Pinto bean
{parent=Plant}

This seems to be the "brown <Brazilian> bean" that many Brazilians eat every day.

Edit: after buying it, not 100% sure. This one felt smaller than what Ciro had in Brazil, <borlotti beans> might be closer. Pinto beans are smaller, and creamier, and have softer peel, possibly produced less <fart>[natural gas].

2021-04: second try.

2021-03: did for first time, started with same procedure as <borlotti beans> 2021-03. Maybe 1h30 is too much. Outcome was still very good.

= Extraterrestrial life
{parent=Species}
{title2=alien}
{wiki}

= Alien
{synonym}

= Extraterrestrial <intelligence>
{parent=Extraterrestrial life}
{wiki}

= Kardashev scale
{c}
{parent=Extraterrestrial life}
{wiki}

= Search for extraterrestrial intelligence
{parent=Extraterrestrial life}
{title2=SETI}
{wiki}

= Communication with extraterrestrial intelligence
{parent=Search for extraterrestrial intelligence}
{title2=CETI}
{wiki}

= Arecibo message
{c}
{parent=Communication with extraterrestrial intelligence}
{wiki}